Saltar al contenido
La Hora Muerta Empieza

El número que CONTROLA el mundo, 42

16 febrero, 2019

¿El número 42 es realmente tan importante, poderoso y misterioso? Empecemos por el universo. El astrónomo holandés Jorg Rachen, que participó en el proyecto del observatorio espacial “Plank”, y el filósofo alemán Ute Gahlings (Ute Gahlings) publicaron un trabajo en el que se señala que los parámetros básicos del modelo cosmológico estándar se pueden obtener combinando Solo tres números: 23, 42 y el número pi.

Los autores formularon un concepto que se llamó cosmología conspirológica, porque las regularidades que revelaron los llevaron a la idea de que los parámetros principales de nuestro universo no son accidentales, sino que están establecidos por algunas fuerzas superiores involucradas en su creación.

Entonces, ¿qué es la “cosmogonía de conspiración” de Rachen y Gahlings?

Los autores comienzan con la definición de un conjunto de constantes de conspiración básicas. En primer lugar, asignan el número 23, igual a la suma de tres primos consecutivos: 5 + 7 + 11. Además, este es el único número entero que se encuentra en el intervalo de Pi a la potencia de e (~ 22.4) a e en el poder Pi (~ 23.1).

El siguiente número que asignan es 42. Si lo escribes en el sistema binario, obtienes 101010 – par 10 tres veces, lo que lleva a 23. Al combinar estos dos números con el número Pi, resulta que puedes obtener un conjunto De los parámetros básicos del modelo cosmológico moderno. Por ejemplo, la proporción de materia bariónica en el universo es 42/1000 de la cantidad total de materia. El valor de la constante de Hubble, que caracteriza la tasa de expansión del Universo H0 = 72 (km / s) / Mpc, es casi igual a 23 * Pi. La proporción de materia oscura es del 23 por ciento, y la proporción de misteriosa energía oscura es del 72 por ciento de la energía gravitacional total del universo, que nuevamente es de 23 * Pi.

El producto 23 * 42 = 966, llamado la constante súper-conspirológica, corresponde claramente a un valor de 0.966, cercano al exponente del espectro de las perturbaciones iniciales de la densidad de la materia, que, como muestran los resultados de la misión Planck, Es ligeramente diferente de la unidad.

Los autores llegan a la conclusión de que tales coincidencias no son accidentales y que nuestro universo fue creado por alguna fuerza razonable, o que el Universo en el sentido habitual de la palabra no existe en absoluto y que el mundo entero no es más que una ilusión. Por ejemplo, un programa de computadora creado para algunos propósitos especiales, conocido solo por sus creadores, a quienes los autores llaman la palabra “ellos”. Lo que coincide bastante con la advertencia del Bank of America Merrill Lynch y el punto de vista de Ilona Mask.

Si asumimos por un momento que la teoría de Rachean y Gahlings es verdadera, el significado de la respuesta, que no es entendido por los personajes de Douglas Adams, se vuelve más claro. De hecho, el número 42, la constante principal, incrustada en la estructura de nuestro universo por sus creadores hipotéticos. Con este enfoque, ya no es sorprendente que el número de casos en los que el número juegue un papel importante en nuestra vida y muerte, o incluso en los destinos de todo el mundo, sea excesivamente frecuente, desde el punto de vista de la teoría de la probabilidad. . Después de todo, la teoría de la probabilidad investiga eventos aleatorios, y este número se integró en el tejido del universo, que se denomina “en diseño”.

El arco iris aparece cuando la luz se refracta y regresa al observador en un ángulo de 42 grados. El arco del arco iris tiene un radio de 42 grados. A una altura de 42 grados, el arco iris desaparece.

La gran Nebulosa de Orión es el objeto difuso más brillante visible en el cielo a simple vista, conocido desde la antigüedad y muy estimulado en su momento el desarrollo de la astronomía. El astrónomo francés del siglo XVII Charles Messier, quien creó el primer catálogo de nebulosas y le asignó el número 42, observamos, claramente no sabía nada acerca de la teoría de Raquel y Gahlings.

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG: así es como la secuencia de ADN es común a todos los vertebrados. Hay 42 caracteres en este registro.

En todos los termómetros médicos de mercurio, la marca “42” está marcada en rojo. Es a esta temperatura que la proteína de la sangre se apaga y la persona muere.

De las ciencias naturales pasamos a la teología y la filosofía. El significado especial del número 42 se puede discernir por la frecuencia con la que aparece en todas las religiones y la importancia que desempeña en ellas.

Los antiguos egipcios asociaron la vida del dios Osiris con dos números: 28 (el número de días en el mes lunar) y 14 (según la leyenda, el cuerpo de Osiris se dividió en 14 partes, que es una alegoría que refleja la disminución de La luna de luna llena a luna nueva en 14 días). En suma, estos dos números dan 42.

En el Libro egipcio de los muertos se dice: en el juicio mortal, la gente responderá por sus 42 pecados mortales ante 42 dioses.

La oración “Ana ba koah” consta de siete líneas, y en cada línea hay seis palabras. Si combinas las primeras letras de todas estas palabras, obtienes el nombre de Dios. Para estudiar Cabalá solo se permite después de cumplir 42 años.

Antes de retirarse al nirvana, Buda respondió las preguntas durante 42 años.

Según las Escrituras, antes del beso fatídico en el Jardín de Getsemaní, Jesús predicó tres años y medio, es decir, 42 meses. Y en la familia tenía: “Hay catorce generaciones desde Abraham hasta David, y desde David hasta el cautiverio en Babilonia, hay catorce generaciones, y desde la migración de Babilonia hasta Cristo son catorce generaciones” (Mateo 1:17). Tres veces catorce – este es el género 42.

El primer libro impreso, la Biblia de Gutenberg, contiene exactamente 42 líneas en cada página.

Los destinos de los gobernantes, la guerra y la paz, según parece, también están estrechamente relacionados con este número.

Hitler, sin duda, fue uno de los personajes más odiados de toda la historia, se realizaron un total de 42 intentos de asesinato fallidos contra Hitler.

En el campamento de los ganadores después del comienzo de la Guerra Fría y en varias de las primeras pruebas nucleares en el centro de Moscú, bajo la Colina Tagansky, se construyó un refugio antinuclear estratégico, diseñado para las primeras personas del estado. Se eligió su ubicación para que, en caso de alarma, el liderazgo de la URSS lograra alcanzar y continuar liderando al ejército y al estado en las condiciones de la guerra nuclear. La orden de crear el búnker fue firmada personalmente por IV Stalin, y el objeto en sí recibió la designación GO-42 (ahora hay un museo popular, abierto para visitas turísticas).

El arquitecto de la actual crisis de la crisis global, el principal conductor de las ideas de la globalización y el hombre que lanzó en todo el mundo una serie de “bombardeos humanitarios” y “establecimiento forzoso de la democracia”, Bill Clinton fue el 42.o gobernador de Arizona y el 42. ° presidente de los Estados Unidos.

Los eventos de Moscú de octubre de 1993, cuando Boris Yeltsin disparó el edificio del Soviet Supremo de la RSFSR desde tanques y en realidad realizó un golpe de estado inconstitucional, marcó el inicio del infame “aplastante 90 m”: oligárquico y bandido. Los contornos ideológicos de este camino de desarrollo del país se perfilaron en el atractivo de las figuras culturales liberales, publicado en el periódico Izvestia. Esta apelación se conoce como “Carta 42”, según el número de escritores que la firmaron.